Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

All conserved microRNAs from Agharbaoui et al. (2015)

Conserved microRNA IDSequenceFamilies1Predicted as microRNAs2
consmRNA_4755
AAAACCUUCAGCUAUCCAUC 20nt [smallrnas]
miR7757 NO
consmRNA_4783
AAGCCUUAGUGAAUAUCUACA 21nt [smallrnas]
miR5200 NO
consmRNA_4874
ACAAAACCUUCAGCUANCCA 20nt [smallrnas]
miR7757 NO
consmRNA_4856
ACAAAACCUUCAGCUAUCCA 20nt [smallrnas]
miR7757 NO
consmRNA_4778
ACAAAACCUUCAGCUAUCCAUC 22nt [smallrnas]
miR7757 NO
consmRNA_3185
AGAAGUGUUUGGGGGAACUG 20nt [smallrnas]
miR395 NO
consmRNA_4626
AGAAUCCUGAUGAUGCUGCAA 21nt [smallrnas]
miR172 NO
consmRNA_3695
AGAAUCCUGAUGAUGCUGCAG 21nt [smallrnas]
miR172 NO
consmRNA_3991
AGAAUCCUGAUGAUGCUGCAGC 22nt [smallrnas]
miR172 NO
consmRNA_945
AGAAUCCUGAUGAUGCUGCCU 21nt [smallrnas]
miR172 NO
consmRNA_4882
AGACUUAUAUUUAGGAACGGA 21nt [smallrnas]
miR1122 NO
consmRNA_1713
AGAUGAGAUUACCCCAUAC 19nt [smallrnas]
miR9772 NO
consmRNA_3993
AGCCAAGGAUGAUUUGCCUGUG 22nt [smallrnas]
miR169 NO
consmRNA_4194
AGCUCCCUUCGAACCAAUC 19nt [smallrnas]
miR159 NO
consmRNA_4834
AGCUGCUCGUUCAUGGUUCC 20nt [smallrnas]
miR159 NO
consmRNA_4880
AGCUGCUCGUUCAUGGUUCCC 21nt [smallrnas]
miR159 NO
consmRNA_4705
AGGCAUACAGGGAGCCAGGCA 21nt [smallrnas]
miR160 NO
consmRNA_4862
AGGGGGCAAUCUCACCUCAA 20nt [smallrnas]
miR9772 NO
consmRNA_4798
AGGGGGCAAUCUCACCUCAAC 21nt [smallrnas]
miR9772 NO
consmRNA_4751
AGGGGGCAAUCUCACCUCAACA 22nt [smallrnas]
miR9772 NO
consmRNA_3761
AGGUGCAGUGGCAUAUGCAAC 21nt [smallrnas]
miR530 NO
consmRNA_4867
AGGUGGAAUACCUGAAGAAGA 21nt [smallrnas]
miR9670 NO
consmRNA_4879
AUAAAACCUUCAGCUAUCCA 20nt [smallrnas]
miR7757 NO
consmRNA_4827
AUAAAACCUUCAGCUAUCCAU 21nt [smallrnas]
miR7757 NO
consmRNA_4851
AUAAAACCUUCAGCUAUCCAUC 22nt [smallrnas]
miR7757 NO
consmRNA_4748
AUAAAACCUUCAGCUAUCCAUCU 23nt [smallrnas]
miR7757 NO
consmRNA_4749
AUAAAACCUUCAGCUAUCCAUCUC 24nt [smallrnas]
miR7757 NO
consmRNA_1805
AUAGCAUCAUCCAUCCUAC 19nt [smallrnas]
miR9674 NO
consmRNA_2936
AUAGCAUCAUCCAUCCUACC 20nt [smallrnas]
miR9674 NO
consmRNA_3711
AUAGCAUCAUCCAUCCUACCA 21nt [apMir_19980]
miR9674 apMir_19980
consmRNA_3941
AUAGCAUCAUCCAUCCUACCAU 22nt [smallrnas]
miR9674 NO
consmRNA_2638
AUAGCAUCGUCCAACCUACCC 21nt [smallrnas]
miR9674 NO
consmRNA_4581
AUAUUUGCAGGUUUUAGGUCUA 22nt [smallrnas]
miR5048 NO
consmRNA_3758
AUGACAGAAGAGAGAGAGCAC 21nt [smallrnas]
miR156 miR157 NO
consmRNA_4407
AUGUGCCUUUCUUCUCCACC 20nt [smallrnas]
miR164 NO
consmRNA_4674
AUUUGCAGGUUUGAGGUCUAA 21nt [smallrnas]
miR5048 NO
consmRNA_4866
CAAAACCUUCAGCUAUCCAUC 21nt [smallrnas]
miR7757 NO
consmRNA_4855
CACAAAACCUUCAGCUANCCA 21nt [smallrnas]
miR7757 NO
consmRNA_4858
CACAAAACCUUCAGCUAUCCA 21nt [smallrnas]
miR7757 NO
consmRNA_4876
CACAAAACCUUCAGCUAUCCAU 22nt [smallrnas]
miR7757 NO
consmRNA_4575
CAGGCAUACAGGGAGCCAGGCA 22nt [smallrnas]
miR160 NO
consmRNA_4769
CAGGGCAAUUCUCCUUUGGCA 21nt [smallrnas]
miR399 NO
consmRNA_3710
CAUAGCAUCAUCCAUCCUACC 21nt [smallrnas]
miR9674 NO
consmRNA_3940
CAUAGCAUCAUCCAUCCUACCA 22nt [smallrnas]
miR9674 NO
consmRNA_4406
CAUGUGCCUUUCUUCUCCAC 20nt [smallrnas]
miR164 NO
consmRNA_4481
CAUGUGCCUUUCUUCUCCACC 21nt [smallrnas]
miR164 NO
consmRNA_4521
CAUGUGCCUUUCUUCUCCACCG 22nt [smallrnas]
miR164 NO
consmRNA_3638
CCACAGGCUUUCUUGAACUG 20nt [smallrnas]
miR396 NO
consmRNA_3888
CCACAGGCUUUCUUGAACUGU 21nt [smallrnas]
miR396 NO
consmRNA_4777
CCGACCUUAGCUCAGUUGGU 20nt [smallrnas]
miR6478 NO
consmRNA_4843
CGUGCUUCCUCGUCGAACGGU 21nt [smallrnas]
miR9657 NO
consmRNA_4036
CUCCACAGGCUUUCUUGAACUG 22nt [smallrnas]
miR396 NO
consmRNA_4817
CUCCGUUCCAGAAUAGAUGAC 21nt [apMir_22267]
miR1137 apMir_22267
consmRNA_1831
CUCGCCGGAGCAGCGUGCA 19nt [smallrnas]
miR531 NO
consmRNA_3841
CUGAAGUGUUUGGGGGAACUC 21nt [smallrnas]
miR395 NO
consmRNA_1906
CUGACAGAAGAGAGAGAGCAC 21nt [smallrnas]
miR156 miR157 NO
consmRNA_4791
CUUAAUGACAGUCGUGGUGUC 21nt [smallrnas]
miR9672 NO
consmRNA_1321
CUUGGACUGAAGGGAGCUCCCU 22nt [smallrnas]
miR319 miR159 NO
consmRNA_4040
CUUGGACUGAAGGGUGCUCCCG 22nt [smallrnas]
miR319 NO
consmRNA_1421
CUUGGAUUGAAGGGAGCU 18nt [smallrnas]
miR159 miR156 NO
consmRNA_2421
CUUGGAUUGAAGGGAGCUC 19nt [smallrnas]
miR159 miR319 NO
consmRNA_3350
CUUGGAUUGAAGGGAGCUCU 20nt [smallrnas]
miR159 miR319 NO
consmRNA_3814
CUUGGAUUGAAGGGAGCUCUC 21nt [smallrnas]
miR159 NO
consmRNA_4648
CUUGGAUUGAAGGGAGCUCUCU 22nt [smallrnas]
miR159 NO
consmRNA_3342
GAAGCUGCCAGCAUGAUCUA 20nt [smallrnas]
miR167 NO
consmRNA_3827
GAAGCUGCCAGCAUGAUCUAG 21nt [smallrnas]
miR167 NO
consmRNA_4639
GAAGUGUUUGGGGGAACUC 19nt [smallrnas]
miR395 NO
consmRNA_267
GAAGUGUUUGGGGGAACUCU 20nt [smallrnas]
miR395 NO
consmRNA_4700
GAAUUUGUCCAUAGCAUCA 19nt [smallrnas]
miR9674 miR5064 NO
consmRNA_4720
GAAUUUGUCCAUAGCAUCAU 20nt [smallrnas]
miR9674 miR5064 NO
consmRNA_1837
GACAGAAGAGAGAGAGCAC 19nt [smallrnas]
miR156 miR157 NO
consmRNA_4644
GACAGAAGAGAGAGAGCACA 20nt [smallrnas]
miR156 NO
consmRNA_4317
GACUCUCUUAAGGUAGCCA 19nt [smallrnas]
miR-4171 NO
consmRNA_3193
GAGAUGAGAUUACCCAAUAC 20nt [smallrnas]
miR9772 NO
consmRNA_1712
GAGAUGAGAUUACCCCAUA 19nt [smallrnas]
miR9772 NO
consmRNA_2896
GAGAUGAGAUUACCCCAUAC 20nt [smallrnas]
miR9772 NO
consmRNA_3684
GAGAUGAGAUUACCCCAUACC 21nt [smallrnas]
miR9772 NO
consmRNA_4337
GAGCUCCUAUCAUUCCAAU 19nt [smallrnas]
miR159 NO
consmRNA_4427
GAGCUCCUAUCAUUCCAAUG 20nt [smallrnas]
miR159 NO
consmRNA_4488
GAGCUCCUAUCAUUCCAAUGA 21nt [smallrnas]
miR159 NO
consmRNA_4525
GAGCUCCUAUCAUUCCAAUGAA 22nt [smallrnas]
miR159 NO
consmRNA_2907
GAUAUUGGCACGGCUCAAUC 20nt [smallrnas]
miR171 NO
consmRNA_3009
GAUAUUGGCGCGGCUCAAUC 20nt [smallrnas]
miR171 NO
consmRNA_3789
GAUAUUGGCGCGGCUCAAUCA 21nt [smallrnas]
miR171 NO
consmRNA_4185
GAUCGUGCUGUGACAGUUUCACC 23nt [smallrnas]
miR167 NO
consmRNA_3336
GAUUGAGCCGUGCCAAUAUC 20nt [smallrnas]
miR171 miR170 NO
consmRNA_4863
GCACAUCCAUGCCCAAGCUCU 21nt [smallrnas]
miR9776 NO
consmRNA_4544
GCAUACAGGGAGCCAGGCA 19nt [smallrnas]
miR160 NO
consmRNA_4763
GCAUCAUCCAUCCUACCAU 19nt [smallrnas]
miR9674 NO
consmRNA_4480
GCAUGUGCCUUUCUUCUCCAC 21nt [smallrnas]
miR164 NO
consmRNA_4650
GCCCCACGGUGGGCGCCA 18nt [smallrnas]
miR5054 NO
consmRNA_3367
GCCUGGCUCCCUGUAUGCCA 20nt [smallrnas]
miR160 NO
consmRNA_4501
GCGUGCACGGAUCCAAGCAUA 21nt [smallrnas]
miR160 NO
consmRNA_4498
GCGUGCGAGGAGCCAAGCAUG 21nt [smallrnas]
miR160 NO
consmRNA_4675
GCGUGCGAGGAGCCAAGCAUGA 22nt [smallrnas]
miR160 NO
consmRNA_4351
GCUCACCCUCUCUCUGUCA 19nt [smallrnas]
miR156 NO
consmRNA_4467
GCUCACCCUCUCUCUGUCAG 20nt [smallrnas]
miR156 NO
consmRNA_4504
GCUCACCCUCUCUCUGUCAGC 21nt [smallrnas]
miR156 NO
consmRNA_4526
GCUCACCCUCUCUCUGUCAGCU 22nt [smallrnas]
miR156 NO
consmRNA_3803
GGAAUCGUGAUGAUGCUGCAG 21nt [smallrnas]
miR172 NO
consmRNA_4811
GGGCAAGUCACCCUGGCUACC 21nt [smallrnas]
miR169 NO
consmRNA_4789
GGGGGCAAUCUCACCUCAAC 20nt [smallrnas]
miR9772 NO
consmRNA_4425
GGGUCGAACUGGGAACACAU 20nt [smallrnas]
miR398 NO
consmRNA_4487
GGGUCGAACUGGGAACACAUG 21nt [smallrnas]
miR398 NO
consmRNA_4835
GUACGAGUGUCUCAGGGCCAAA 22nt [smallrnas]
miR6201 NO
consmRNA_3759
GUGAAGUGUUUGGGGGAACUC 21nt [smallrnas]
miR395 NO
consmRNA_1592
GUGAAGUGUUUGGGGGAACUCU 22nt [smallrnas]
miR395 NO
consmRNA_3770
GUGUUCUCAGGUCGCCCCCGC 21nt [smallrnas]
miR398 NO
consmRNA_299
GUUCAAGAAAGCCUGUGGAAA 21nt [smallrnas]
miR396 NO
consmRNA_3889
GUUCAAGAAAGUCCUUGGAAA 21nt [smallrnas]
miR396 NO
consmRNA_3842
GUUCCCUGCAAGCACUUCACG 21nt [smallrnas]
miR395 NO
consmRNA_486
GUUCCCUGCAAGCACUUCACGA 22nt [smallrnas]
miR395 NO
consmRNA_4753
GUUCCUUGCAAGCACUUCAUG 21nt [smallrnas]
miR395 NO
consmRNA_4795
GUUCCUUGCAAGCACUUCAUGA 22nt [smallrnas]
miR395 NO
consmRNA_4719
GUUCUCUUCAAGCACUUCAGG 21nt [smallrnas]
miR395 NO
consmRNA_1291
GUUGUCUCAAGCUUGCUGCCU 21nt [smallrnas]
miR444 NO
consmRNA_4828
UAAAACCUUCAGCUAUCCAU 20nt [smallrnas]
miR7757 NO
consmRNA_4861
UAAAACCUUCAGCUAUCCAUC 21nt [smallrnas]
miR7757 NO
consmRNA_4875
UAAAACCUUCAGCUAUCCAUCU 22nt [smallrnas]
miR7757 NO
consmRNA_4746
UAAGCCUUAGUGAAUAUCUAC 21nt [smallrnas]
miR5200 NO
consmRNA_2937
UAGCAUCAUCCAUCCUACCA 20nt [smallrnas]
miR9674 NO
consmRNA_53
UAGCCAAGGAUGAUUUGCC 19nt [smallrnas]
miR169 NO
consmRNA_3846
UAGCCAAGGAUGAUUUGCCUG 21nt [smallrnas]
miR169 NO
consmRNA_3992
UAGCCAAGGAUGAUUUGCCUGU 22nt [smallrnas]
miR169 NO
consmRNA_689
UAGCCAAGGAUGAUUUGCCUGUG 23nt [smallrnas]
miR169 NO
consmRNA_4578
UAGCCAAGGAUGAUUUGCCUGUGA 24nt [smallrnas]
miR169 NO
consmRNA_4688
UAUUUGCAGGUUUUAGGUCUAA 22nt [smallrnas]
miR5048 NO
consmRNA_4537
UCAAGCAUCAUAUCAUGGAC 20nt [smallrnas]
miR5071 NO
consmRNA_4703
UCAAGCAUCAUAUCAUGGACA 21nt [smallrnas]
miR5071 NO
consmRNA_4548
UCAAGCAUCAUAUCAUGGACAC 22nt [smallrnas]
miR5071 NO
consmRNA_4618
UCAAGCAUCAUGUCAUGGACA 21nt [smallrnas]
miR5071 NO
consmRNA_2191
UCCACAGGCUUUCUUGAAC 19nt [smallrnas]
miR396 NO
consmRNA_3235
UCCACAGGCUUUCUUGAACG 20nt [smallrnas]
miR396 NO
consmRNA_3788
UCCACAGGCUUUCUUGAACGA 21nt [smallrnas]
miR396 NO
consmRNA_4729
UCCACAGGCUUUCUUGAACGAU 22nt [smallrnas]
miR396 NO
consmRNA_3637
UCCACAGGCUUUCUUGAACU 20nt [smallrnas]
miR396 NO
consmRNA_3887
UCCACAGGCUUUCUUGAACUG 21nt [smallrnas]
miR396 NO
consmRNA_4037
UCCACAGGCUUUCUUGAACUGU 22nt [smallrnas]
miR396 NO
consmRNA_747
UCCACAGGCUUUCUUGAACUGUC 23nt [smallrnas]
miR396 NO
consmRNA_4838
UCCCCGGCAACGGCGCCA 18nt [apMir_11506]
miR8175 apMir_11506
consmRNA_4814
UCCGUUCCAAAAUAGAUGACC 21nt [smallrnas]
miR1137 NO
consmRNA_4805
UCCGUUCCAAAAUAGAUGACU 21nt [smallrnas]
miR1137 NO
consmRNA_1415
UGAAGCUGCCAGCAUGAU 18nt [smallrnas]
miR167 NO
consmRNA_2188
UGAAGCUGCCAGCAUGAUC 19nt [smallrnas]
miR167 NO
consmRNA_3231
UGAAGCUGCCAGCAUGAUCU 20nt [smallrnas]
miR167 NO
consmRNA_3785
UGAAGCUGCCAGCAUGAUCUA 21nt [apMir_21380]
miR167 apMir_21380
consmRNA_4632
UGAAGCUGCCAGCAUGAUCUAA 22nt [smallrnas]
miR167 NO
consmRNA_607
UGAAGCUGCCAGCAUGAUCUAAC 23nt [smallrnas]
miR167 NO
consmRNA_4652
UGAAGCUGCCAGCAUGAUCUAG 22nt [apMir_24939]
miR167 apMir_24939
consmRNA_647
UGAAGCUGCCAGCAUGAUCUAGC 23nt [smallrnas]
miR167 NO
consmRNA_1409
UGAAGUGUUUGGGGGAAC 18nt [smallrnas]
miR395 NO
consmRNA_1839
UGAAGUGUUUGGGGGAACU 19nt [smallrnas]
miR395 NO
consmRNA_3183
UGAAGUGUUUGGGGGAACUC 20nt [apMir_17808]
miR395 apMir_17808
consmRNA_327
UGAAGUGUUUGGGGGAACUCU 21nt [apMir_20968]
miR395 apMir_20968
consmRNA_4696
UGAAUUUGUCCAUAGCAUC 19nt [smallrnas]
miR9674 NO
consmRNA_4569
UGAAUUUGUCCAUAGCAUCA 20nt [smallrnas]
miR9674 miR5064 NO
consmRNA_4628
UGAAUUUGUCCAUAGCAUCAU 21nt [smallrnas]
miR9674 miR5064 NO
consmRNA_4547
UGAAUUUGUCCAUAGCAUCAUC 22nt [smallrnas]
miR9674 NO
consmRNA_1812
UGACAGAAGAGAGAGAGCA 19nt [smallrnas]
miR156 miR157 NO
consmRNA_3007
UGACAGAAGAGAGAGAGCAC 20nt [smallrnas]
miR156 miR157 NO
consmRNA_325
UGACAGAAGAGAGAGAGCACA 21nt [smallrnas]
miR156 miR157 NO
consmRNA_3724
UGACAGAAGAGAGAGAGCACG 21nt [smallrnas]
miR156 miR157 NO
consmRNA_3027
UGACAGAAGAGAGAGAGCAU 20nt [smallrnas]
miR156 miR157 NO
consmRNA_1808
UGACAGAAGAGAGGGAGCA 19nt [smallrnas]
miR156 NO
consmRNA_2943
UGACAGAAGAGAGGGAGCAU 20nt [smallrnas]
miR156 NO
consmRNA_3995
UGACCCUGAGGCACUCAUACCG 22nt [smallrnas]
miR6201 NO
consmRNA_4312
UGACUCUCUUAAGGUAGCC 19nt [smallrnas]
miR-4171 NO
consmRNA_4408
UGACUCUCUUAAGGUAGCCA 20nt [smallrnas]
miR-4171 NO
consmRNA_4509
UGACUCUCUUAAGGUAGCCAA 21nt [smallrnas]
miR-4171 NO
consmRNA_3951
UGAGAAGGCAGAUCAUAAUAGC 22nt [apMir_23614]
miR9863 apMir_23614
consmRNA_3001
UGAGAAGGUAGAUCAUAAUA 20nt [smallrnas]
miR9863 NO
consmRNA_3950
UGAGAAGGUAGAUCAUAAUAGC 22nt [apMir_23846]
miR9863 apMir_23846
consmRNA_3192
UGAGAUGAGAUUACCCAAUA 20nt [smallrnas]
miR9772 NO
consmRNA_3766
UGAGAUGAGAUUACCCAAUAC 21nt [apMir_21052]
miR9772 apMir_21052
consmRNA_1303
UGAGAUGAGAUUACCCAAUACC 22nt [smallrnas]
miR9772 NO
consmRNA_1711
UGAGAUGAGAUUACCCCAU 19nt [smallrnas]
miR9772 NO
consmRNA_2895
UGAGAUGAGAUUACCCCAUA 20nt [smallrnas]
miR9772 NO
consmRNA_3683
UGAGAUGAGAUUACCCCAUAC 21nt [apMir_19484]
miR9772 apMir_19484
consmRNA_3927
UGAGAUGAGAUUACCCCAUACC 22nt [smallrnas]
miR9772 NO
consmRNA_4816
UGAGAUGAGAUUACCCCAUACCC 23nt [smallrnas]
miR9772 NO
consmRNA_1419
UGAUUGAGCCGUGCCAAU 18nt [smallrnas]
miR171 NO
consmRNA_2201
UGAUUGAGCCGUGCCAAUA 19nt [smallrnas]
miR171 NO
consmRNA_3335
UGAUUGAGCCGUGCCAAUAU 20nt [smallrnas]
miR171 miR170 NO
consmRNA_3806
UGAUUGAGCCGUGCCAAUAUC 21nt [smallrnas]
miR171 miR170 NO
consmRNA_4680
UGAUUGAGCCGUGCCAAUAUCU 22nt [smallrnas]
miR171 miR170 NO
consmRNA_350
UGCAGUUGCUGCCUCAAGCUC 21nt [smallrnas]
miR444 NO
consmRNA_3727
UGCAGUUGCUGCCUCAAGCUU 21nt [smallrnas]
miR444 NO
consmRNA_2931
UGCAGUUGCUGUCUCAAGCU 20nt [smallrnas]
miR444 NO
consmRNA_3757
UGCAGUUGCUGUCUCAAGCUU 21nt [apMir_19892]
miR444 apMir_19892
consmRNA_4602
UGCAGUUGUUGUCUCAAGCUU 21nt [smallrnas]
miR444 NO
consmRNA_2205
UGCAUCAUCUCGAACUCGU 19nt [smallrnas]
miR9778 NO
consmRNA_3344
UGCAUCAUCUCGAACUCGUC 20nt [apMir_18447]
miR9778 apMir_18447
consmRNA_3811
UGCAUCAUCUCGAACUCGUCG 21nt [apMir_21970]
miR9778 apMir_21970
consmRNA_471
UGCAUCAUCUCGAACUCGUCGG 22nt [apMir_24947]
miR9778 apMir_24947
consmRNA_649
UGCAUCAUCUCGAACUCGUCGGU 23nt [smallrnas]
miR9778 NO
consmRNA_332
UGCAUUUGCACCUGCACCUGC 21nt [smallrnas]
miR530 NO
consmRNA_4660
UGCCAAAGGAGAAUUACCCCC 21nt [smallrnas]
miR399 NO
consmRNA_1937
UGCCAAAGGAGAAUUACCCCU 21nt [smallrnas]
miR399 NO
consmRNA_406
UGCCAAAGGAGAAUUGCCCUG 21nt [smallrnas]
miR399 NO
consmRNA_3860
UGCCAAAGGAGAGUUGCCCUG 21nt [apMir_21995]
miR399 apMir_21995
consmRNA_2184
UGCCUGGCUCCCUGUAUGC 19nt [smallrnas]
miR160 NO
consmRNA_3820
UGCCUGGCUCCCUGUAUGCCA 21nt [apMir_22246]
miR160 apMir_22246
consmRNA_4738
UGCCUGGCUCCCUGUAUGCCAC 22nt [smallrnas]
miR160 NO
consmRNA_662
UGCCUGGCUCCCUGUAUGCCACU 23nt [smallrnas]
miR160 NO
consmRNA_3780
UGCCUGGCUCCCUGUAUGCCU 21nt [smallrnas]
miR160 NO
consmRNA_452
UGCCUGGCUCCCUGUAUGCCUG 22nt [smallrnas]
miR160 NO
consmRNA_3901
UGGACGAGGAUGUGCAACUGC 21nt [apMir_23192]
miR9776 apMir_23192
consmRNA_4638
UGGACUGAAGGGAGCUCCCUC 21nt [smallrnas]
miR319 NO
consmRNA_4313
UGGAGAAGCAGGGCACUUG 19nt [smallrnas]
miR164 NO
consmRNA_3003
UGGAGAAGCAGGGCACUUGC 20nt [smallrnas]
miR164 NO
consmRNA_3734
UGGAGAAGCAGGGCACUUGCU 21nt [smallrnas]
miR164 NO
consmRNA_4684
UGGAGAAGCAGGUCACGUG 19nt [smallrnas]
miR164 NO
consmRNA_4742
UGGAUGUCAUCAUGGCCGUACA 22nt [smallrnas]
miR9676 NO
consmRNA_4820
UGGGCAAGUCACCCUGGCUAC 21nt [smallrnas]
miR169 NO
consmRNA_4837
UGGGCAAGUCACCCUGGCUACC 22nt [smallrnas]
miR169 NO
consmRNA_4836
UGGGCAAGUCACCCUGGCUACCC 23nt [smallrnas]
miR169 NO
consmRNA_3906
UGUAGAUACUCCCUAAGGCUU 21nt [smallrnas]
miR5200 NO
consmRNA_3769
UGUGUUCUCAGGUCGCCCCCG 21nt [smallrnas]
miR398 NO
consmRNA_4796
UGUUAUGAUCUGCUUCUCAUC 21nt [smallrnas]
miR9863 NO
consmRNA_4877
UGUUAUGAUCUGCUUCUCAUU 21nt [smallrnas]
miR9863 NO
consmRNA_4496
UGUUGGCUCGACUCACUCAGA 21nt [smallrnas]
miR171 NO
consmRNA_3718
UGUUGUCUCAAGCUUGCUGCC 21nt [smallrnas]
miR444 NO
consmRNA_1828
UUAGAUGACCAUCAGCAAA 19nt [smallrnas]
miR827 NO
consmRNA_3036
UUAGAUGACCAUCAGCAAAC 20nt [smallrnas]
miR827 NO
consmRNA_3742
UUAGAUGACCAUCAGCAAACA 21nt [smallrnas]
miR827 NO
consmRNA_3966
UUAGAUGACCAUCAGCAAACAU 22nt [smallrnas]
miR827 NO
consmRNA_4826
UUCCGAAAGGCUUGAAGCAAAU 22nt [apMir_23912]
miR9654 apMir_23912
consmRNA_4621
UUGAAUUUGUCCAUAGCAUCA 21nt [smallrnas]
miR9674 NO
consmRNA_4698
UUGAAUUUGUCCAUAGCAUCAU 22nt [smallrnas]
miR9674 NO
consmRNA_1822
UUGACAGAAGAGAGAGAGC 19nt [smallrnas]
miR156 NO
consmRNA_3026
UUGACAGAAGAGAGAGAGCA 20nt [smallrnas]
miR156 miR157 NO
consmRNA_3737
UUGACAGAAGAGAGAGAGCAU 21nt [smallrnas]
miR156 miR157 NO
consmRNA_1824
UUGACAGAAGAGAGGGAGC 19nt [smallrnas]
miR156 NO
consmRNA_3030
UUGACAGAAGAGAGGGAGCA 20nt [smallrnas]
miR156 NO
consmRNA_3736
UUGACAGAAGAGAGGGAGCAU 21nt [smallrnas]
miR156 NO
consmRNA_3977
UUGAGAUGAGAUUACCCAAUAC 22nt [smallrnas]
miR9772 NO
consmRNA_3682
UUGAGAUGAGAUUACCCCAUA 21nt [smallrnas]
miR9772 NO
consmRNA_3926
UUGAGAUGAGAUUACCCCAUAC 22nt [smallrnas]
miR9772 NO
consmRNA_4854
UUGAGAUGAGAUUACCCCAUACC 23nt [smallrnas]
miR9772 NO
consmRNA_4320
UUGAGCCGUGCCAAUAUCUCA 21nt [smallrnas]
miR171 NO
consmRNA_4744
UUGCAGGUUUGAGGUCUAAGU 21nt [smallrnas]
miR5048 NO
consmRNA_4824
UUGCAGGUUUUAGGUCUAAGUG 22nt [smallrnas]
miR5048 NO
consmRNA_407
UUGGACGAGGAUGUGCAACUG 21nt [smallrnas]
miR9776 NO
consmRNA_3565
UUGGACUGAAGGGUGCUCCC 20nt [smallrnas]
miR319 NO
consmRNA_3844
UUGGACUGAAGGGUGCUCCCG 21nt [smallrnas]
miR319 NO
consmRNA_4041
UUGGACUGAAGGGUGCUCCCGU 22nt [smallrnas]
miR319 NO
consmRNA_1406
UUGGAUUGAAGGGAGCUC 18nt [smallrnas]
miR159 miR319 NO
consmRNA_1835
UUGGAUUGAAGGGAGCUCU 19nt [smallrnas]
miR159 miR319 NO
consmRNA_3351
UUGGAUUGAAGGGAGCUCUC 20nt [smallrnas]
miR159 NO
consmRNA_3042
UUGGAUUGAAGGGAGCUCUG 20nt [smallrnas]
miR159 NO
consmRNA_3793
UUGGAUUGAAGGGAGCUCUGC 21nt [smallrnas]
miR159 NO
consmRNA_1514
UUGGCAUUCUGUCCACCU 18nt [smallrnas]
miR394 miR384 NO
consmRNA_1799
UUGGCAUUCUGUCCACCUC 19nt [smallrnas]
miR394 miR384 NO
consmRNA_3004
UUGGCAUUCUGUCCACCUCC 20nt [smallrnas]
miR394 miR384 NO
consmRNA_3701
UUGGCAUUCUGUCCACCUCCU 21nt [smallrnas]
miR394 miR384 NO
consmRNA_334
UUGUGGCUUUCUUGCAAGUCG 21nt [smallrnas]
miR444 NO
consmRNA_4809
UUUGCAGGUUUGAGGUCUAAG 21nt [smallrnas]
miR5048 NO
consmRNA_4702
UUUGCAGGUUUUAGGUCUAAG 21nt [smallrnas]
miR5048 NO
consmRNA_4865
UUUGCAGGUUUUAGGUCUAAGU 22nt [smallrnas]
miR5048 NO
consmRNA_4771
UUUGCAGGUUUUAGGUCUAAGUG 23nt [smallrnas]
miR5048 NO
consmRNA_4790
UUUGCAUGACCGAGGAGCCGC 21nt [smallrnas]
miR159 NO
consmRNA_4538
UUUGGAUUGAAGGGAGCU 18nt [smallrnas]
miR156 NO
consmRNA_1834
UUUGGAUUGAAGGGAGCUC 19nt [smallrnas]
miR159 NO
consmRNA_3041
UUUGGAUUGAAGGGAGCUCU 20nt [smallrnas]
miR159 NO
consmRNA_3755
UUUGGAUUGAAGGGAGCUCUG 21nt [apMir_20860]
miR159 apMir_20860
consmRNA_3973
UUUGGAUUGAAGGGAGCUCUGC 22nt [smallrnas]
miR159 NO
consmRNA_579
UUUGGAUUGAAGGGAGCUCUGCA 23nt [smallrnas]
miR159 NO
1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
2The prediction is based on the mirDup and mircheck microRNA predictors. See the citation section for the complete method reference.
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot