Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_1321

CUUGGACUGAAGGGAGCUCCCU 22nt
Associated miRBase1 families
miR319 miR159 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
nta-miR319b
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
mtr-miR319b-3p
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
mes-miR319b
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
pta-miR159c
CUUGGAUUGAAGGGAGCUCCC
101295.240.0001miR159
lus-miR319b
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
mtr-miR319d-3p
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
gma-miR319h
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
ptc-miR319a
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
ctr-miR319
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
mes-miR319c
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
ptc-miR319c
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
hbr-miR319
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
rco-miR319b
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
cme-miR319a
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
ppt-miR319a
CUUGGACUGAAGGGAGCUCC
00221008e-06miR319
ptc-miR319d
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
aau-miR319
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
smo-miR159
CUUGGAUUGAAGGGAGCUCCC
101295.240.0001miR159
mes-miR319h
CUUGGACUGAAGGGAGCUCCU
01121008e-06miR319
bra-miR319-3p
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
mdm-miR319a
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
ppt-miR319c
CUUGGACUGAAGGGAGCUCCC
00111002e-06miR319
vun-miR319b
CUUGGACUGAAGGGAGCUCCU
01121008e-06miR319
amg-miR319
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
bdi-miR319b-3p
UUGGACUGAAGGGUGCUCCCU
101295.240.0001miR319
ppt-miR319d-3p
CUUGGACUGAAGGGAGCUCCC
00111002e-06miR319
mtr-miR319a-3p
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
sly-miR319a
CUUGGACUGAAGGGAGCUCC
00221008e-06miR319
ath-miR319b
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
ath-miR319a
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
rco-miR319c
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
nta-miR319a
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
ppt-miR319e
CUUGGACUGAAGGGAGCUCCC
00111002e-06miR319
gma-miR319b
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
mes-miR319a
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
sly-miR319b
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
vvi-miR319f
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
vun-miR319a
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
ppe-miR319a
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
vvi-miR319b
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
cme-miR319b
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
atr-miR319c
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
mes-miR319d
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
vvi-miR319g
UUGGACUGAAGGGAGCUCCCA
01121008e-06miR319
rco-miR319a
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
ptc-miR319b
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
stu-miR319a-3p
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
vvi-miR319c
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
gma-miR319e
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
mes-miR319e
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
aly-miR319b-3p
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
mdm-miR319b
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
gma-miR319a
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
mtr-miR319c-3p
UUGGACUGAAGGGAGCUCCCA
01121008e-06miR319
gma-miR319m
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
lus-miR319a
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
ppt-miR319b
CUUGGACUGAAGGGAGCUCC
00221008e-06miR319
aly-miR319a-3p
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
cca-miR319
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
gma-miR319k
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
atr-miR319a
UUGGACUGAAGGGAGCUCCC
00221008e-06miR319
aqc-miR319
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
tae-miR319
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319
gma-miR319j
UUGGACUGAAGGGAGCUCCCU
00111002e-06miR319

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot