Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_1406

UUGGAUUGAAGGGAGCUC 18nt
Associated miRBase1 families
miR159 miR319 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
bdi-miR159a-3p
CUUGGAUUGAAGGGAGCUCU
00221000.0001miR159
pta-miR159a
UUGGAUUGAAGGGAGCUCCA
00221000.0001miR159
mdm-miR159a
CUUGGAUUGAAGGGAGCUCC
00221000.0001miR159
cpa-miR159b
CUUGGAUUGAAGGGAGCUCC
00221000.0001miR159
mdm-miR159b
CUUGGAUUGAAGGGAGCUCC
00221000.0001miR159
pta-miR319
UUGGACUGAAGGGAGCUCC
101294.440.004miR319

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Amine M. Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot