Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_1409

UGAAGUGUUUGGGGGAAC 18nt
Associated miRBase1 families
miR395 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
tae-miR395b
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
cpa-miR395e
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395q
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395b
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
ata-miR395c-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395m
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
cpa-miR395d
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
cpa-miR395b
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
ata-miR395e-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395l-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
ata-miR395f-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395j-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395c-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395f-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395n-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
cpa-miR395c
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395h-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
ata-miR395a-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
cpa-miR395a
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395a
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
ata-miR395d-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395e-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395k-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395o-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395
bdi-miR395g-3p
UGAAGUGUUUGGGGGAACUC
00221000.0001miR395

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot