Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_1514

UUGGCAUUCUGUCCACCU 18nt
Associated miRBase1 families
miR394 miR384 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
sbi-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ppe-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
vvi-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
nta-miR394
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
lus-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
aly-miR394a-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
gma-miR394b-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ahy-miR394
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
cpa-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
gma-miR394a-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
bna-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
osa-miR394
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
cca-miR394
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
mdm-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
csi-miR394
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
cme-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ghr-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
gma-miR394g
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
mes-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
atr-miR394
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ptc-miR394a-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
gma-miR394d
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
gma-miR394e
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ssl-miR394
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ath-miR394b-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
zma-miR394a-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
tcc-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ptc-miR394b-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ppe-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
bna-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
mdm-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ath-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
sbi-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
bdi-miR394
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
aly-miR394b-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
mes-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
stu-miR384-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR384
gma-miR394f
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ata-miR394-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
sly-miR394-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
tcc-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
lus-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
ghr-miR394b
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
cme-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
gma-miR394c-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
zma-miR394b-5p
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394
cpa-miR394a
UUGGCAUUCUGUCCACCUCC
00221000.0001miR394

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Amine M. Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot