Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_2931

UGCAGUUGCUGUCUCAAGCU 20nt
Associated miRBase1 families
miR444 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
hvu-miR444b
UGCAGUUGCUGUCUCAAGCUU
00111008e-06miR444
osa-miR444c.2
UGCAGUUGUUGUCUCAAGCUU
1012950.0004miR444
ssp-miR444c-3p
UGCAGUUGUUGUCUCAAGCUU
1012950.0004miR444
osa-miR444b.2
UGCAGUUGUUGUCUCAAGCUU
1012950.0004miR444
bdi-miR444c
UGCAGUUGUUGUCUCAAGCUU
1012950.0004miR444
zma-miR444a
UGCAGUUGUUGUCUCAAGCUU
1012950.0004miR444
osa-miR444a-3p.2
UGCAGUUGCUGCCUCAAGCUU
1012950.0004miR444
osa-miR444e
UGCAGUUGCUGCCUCAAGCUU
1012950.0004miR444
osa-miR444d.2
UGCAGUUGCUGCCUCAAGCUU
1012950.0004miR444
bdi-miR444b
UGCAGUUGCUGCCUCAAGCUU
1012950.0004miR444
bdi-miR444d
UGCAGUUGUUGUCUCAAGCUU
1012950.0004miR444
zma-miR444b
UGCAGUUGUUGUCUCAAGCUU
1012950.0004miR444

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot