Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3003

UGGAGAAGCAGGGCACUUGC 20nt
Associated miRBase1 families
miR164 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
rco-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
gma-miR164c
UGGAGAAGCAGGGCACGUGC
1001950.0004miR164
sbi-miR164b
UGGAGAAGCAGGGCACGUGCU
1012950.0004miR164
bdi-miR164c-5p
UGGAGAAGCAGGGCACGUGCU
1012950.0004miR164
lus-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
sly-miR164a-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
vvi-miR164d
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
atr-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ptc-miR164f
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
bna-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
cme-miR164a
UGGAGAAGCAGGGCACGUGCU
1012950.0004miR164
ssl-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ata-miR164a-5p
UGGAGAAGCAGGGCACGUGCU
1012950.0004miR164
mes-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
mtr-miR164d
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
mes-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
mdm-miR164a
UGGAGAAGCAGGGCACAUGCC
1012950.0004miR164
tcc-miR164c
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
cme-miR164d
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ptc-miR164d
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
bdi-miR164e
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ath-miR164b-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
lus-miR164e
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
cpa-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
tcc-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
zma-miR164b-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
mtr-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ptc-miR164e
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
rco-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ata-miR164b-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
nta-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ppe-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
lus-miR164d
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
gma-miR164j
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
sly-miR164b-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
sbi-miR164d
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
mes-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
bra-miR164b-5p
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
cln-miR164
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
mdm-miR164e
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
osa-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
far-miR164a
UGGAGAAGCAGGGCACUUGCU
00111008e-06miR164
bdi-miR164a-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ghr-miR164
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ptc-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
bna-miR164c
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
mdm-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
gma-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
stu-miR164-5p
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
gma-miR164e
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
vvi-miR164b
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
bdi-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
mtr-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
cme-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
aly-miR164c-5p
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
cpa-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ata-miR164c-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ppe-miR164d
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
vvi-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ptc-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
mes-miR164d
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
ssl-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
gma-miR164k
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
osa-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
mdm-miR164d
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
bna-miR164b
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
mdm-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
csi-miR164
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
sbi-miR164e
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
osa-miR164f
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
gma-miR164g
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
zma-miR164g-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
zma-miR164c-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
nta-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
sbi-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
aly-miR164b-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
bra-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
aly-miR164a-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ppe-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
tae-miR164
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
osa-miR164d
UGGAGAAGCAGGGCACGUGCU
1012950.0004miR164
mtr-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
mdm-miR164f
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
gma-miR164f
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
zma-miR164d-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
tcc-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
bra-miR164d-5p
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
gma-miR164i
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
zma-miR164a-5p
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ppe-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ath-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ptc-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
zma-miR164f-5p
UGGAGAAGCAGGGCACGUGCU
1012950.0004miR164
gma-miR164h
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
atr-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
cpa-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
bra-miR164c-5p
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
ath-miR164c-5p
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
lus-miR164c
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
gma-miR164d
UGGAGAAGCAGGGCACGUGC
1001950.0004miR164
far-miR164b
UGGAGAAGCAGGGCACUUGCU
00111008e-06miR164
bna-miR164d
UGGAGAAGCAGGGCACGUGCG
1012950.0004miR164
rco-miR164d
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
rco-miR164b
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
nta-miR164c
UGGAGAAGCAGGGCACAUGCU
1012950.0004miR164
vvi-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
ctr-miR164
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
lus-miR164a
UGGAGAAGCAGGGCACGUGCA
1012950.0004miR164
gma-miR164b
UGGAGAAGCAGGGCACGUGC
1001950.0004miR164

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot