Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3026

UUGACAGAAGAGAGAGAGCA 20nt
Associated miRBase1 families
miR156 miR157 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
ptc-miR156i
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
lus-miR156e
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
vun-miR156b
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ppe-miR156g
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
stu-miR156a
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
cca-miR156c
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ptc-miR156g
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ath-miR157b-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
gma-miR156c
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
rco-miR156f
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
gma-miR156m
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
han-miR156c
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
tcc-miR156f
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
far-miR156b
UUGACAGAAGAGAGAGAGCAC
00111008e-06miR156
stu-miR156d-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
lus-miR156b
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ahy-miR156c
UUGACAGAAGAGAGAGAGCAC
00111008e-06miR156
sly-miR156a
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
mes-miR156j
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
gma-miR156o
UUGACAGAAGAGAGUGAGCAC
1012950.0004miR156
lus-miR156h
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
gma-miR156e
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ath-miR156i
UGACAGAAGAGAGAGAGCAG
00221003e-05miR156
rco-miR156h
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
vvi-miR156i
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
bna-miR156c
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
vvi-miR156g
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ppe-miR156i
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
mdm-miR156ab
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ath-miR157a-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
mdm-miR156u
UUGACAGAAGAGAGAGAGCAC
00111008e-06miR156
gra-miR157b
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
gma-miR156l
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
smo-miR156c
UUGACAGAAGAAAGAGAGCAC
1012950.0004miR156
har-miR156c
UGACAGAAGAGAGGGAGCA
101294.740.001miR156
mtr-miR156h-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
gma-miR156j
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
sly-miR156c
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ppe-miR156h
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
aly-miR157a-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
ath-miR157c-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
cpa-miR156e
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
atr-miR156c
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ptc-miR156h
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
mdm-miR156v
UUGACAGAAGAGAGAGAGCAC
00111008e-06miR156
mdm-miR156ac
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
hbr-miR156
UUGACAGAAGAUAGAGAGC
101294.740.001miR156
sly-miR156b
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
mtr-miR156e
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
bna-miR156g
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
cme-miR156b
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
mes-miR156i
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
aly-miR157c-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
ahy-miR156b-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
stu-miR156b
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
hpa-miR156a
UGACAGAAGAGAGAGAGCAC
00221003e-05miR156
mdm-miR156w
UUGACAGAAGAGAGAGAGCAC
00111008e-06miR156
gma-miR156k
UUGACAGAAGAGAGUGAGCAC
1012950.0004miR156
lus-miR156i
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
lus-miR156f
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
tcc-miR156e
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
bra-miR157a
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
stu-miR156c
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
aly-miR157b-5p
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
lus-miR156c
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
gma-miR156n
UUGACAGAAGAGAGUGAGCAC
1012950.0004miR156
gma-miR156i
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
gra-miR157a
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
vvi-miR156h
UGACAGAAGAGAGAGAGCAU
00221003e-05miR156
ahy-miR156a
UGACAGAAGAGAGAGAGCAC
00221003e-05miR156
ath-miR156j
UGACAGAAGAGAGAGAGCAC
00221003e-05miR156
stu-miR156f-5p
CUGACAGAAGAGAGUGAGCA
110294.740.001miR156
gma-miR156d
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
mdm-miR156t
UUGACAGAAGAGAGAGAGCAC
00111008e-06miR156
cpa-miR156f
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
bdi-miR156j
UGACAGAAGAGAGAGAGCAC
00221003e-05miR156
rco-miR156g
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
gma-miR156f
UUGACAGAAGAGAGAGAGCACA
00221008e-06miR156
bol-miR157a
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR157
vvi-miR156f
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
bna-miR156b
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
mtr-miR156f
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
mes-miR156h
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
atr-miR156a
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156
ptc-miR156j
UUGACAGAAGAUAGAGAGCAC
1012950.0004miR156

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot