Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3036

UUAGAUGACCAUCAGCAAAC 20nt
Associated miRBase1 families
miR827 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
ghr-miR827b
UUAGAUGACCAUCAACAAACA
1012950.0004miR827
ssp-miR827
UUAGAUGACCAUCAGCAAACA
00111008e-06miR827
ghr-miR827c
UUAGAUGACCAUCAACAAACA
1012950.0004miR827
csi-miR827
UUAGAUGACCAUCAACAAACA
1012950.0004miR827
ppe-miR827
UUAGAUGACCAUCAACAAACA
1012950.0004miR827
ath-miR827
UUAGAUGACCAUCAACAAACU
1012950.0004miR827
mes-miR827
UUAGAUGACCAUCAACAAACA
1012950.0004miR827
aly-miR827-3p
UUAGAUGACCAUCAACAAACG
1012950.0004miR827
bdi-miR827-3p
UUAGAUGACCAUCAGCAAACA
00111008e-06miR827
ghr-miR827a
UUAGAUGACCAUCAACAAACA
1012950.0004miR827
zma-miR827-3p
UUAGAUGACCAUCAGCAAACA
00111008e-06miR827
osa-miR827
UUAGAUGACCAUCAGCAAACA
00111008e-06miR827
tcc-miR827
UUAGAUGACCAUCAACAAACA
1012950.0004miR827

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot