Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3183

UGAAGUGUUUGGGGGAACUC 20nt
Associated miRBase1 families
miR395 
Predicted by our predictors: apMir_17808

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
mdm-miR395i
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
tcc-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395e
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ath-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395i
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bra-miR395b-3p
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sbi-miR395a
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395l
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ptc-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395e-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mes-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
stu-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395j
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
tae-miR395b
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
gma-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cme-miR395e
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395k
UUGAAGCGUUUGGGGGAACUC
1012950.0004miR395
ppe-miR395m
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395a-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cpa-miR395e
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
osa-miR395h
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
stu-miR395i
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395q
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
bna-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ptc-miR395j
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395i
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
lus-miR395e
CUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
ptc-miR395e
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ath-miR395f
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
ath-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
lus-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395b
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
osa-miR395y
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395m-3p
GUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
mdm-miR395e
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cme-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ata-miR395c-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
lus-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395g
UGAAGUGUUUGGGGGAACUUU
01121003e-05miR395
osa-miR395k
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395k
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395m
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
nta-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mdm-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395e
UGAAGUGUUUGGGGGAACUUU
01121003e-05miR395
mtr-miR395b
AUGAAGUAUUUGGGGGAACUC
1012950.0004miR395
ptc-miR395g
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395e
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395f
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
nta-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bra-miR395a-3p
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ath-miR395c
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
osa-miR395d
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sbi-miR395i
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cpa-miR395d
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
bna-miR395d
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
sbi-miR395k
GUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
osa-miR395t
GUGAAGUGUUUGGGGAAACUC
1012950.0004miR395
ppe-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395f
GUGAAUUGUUUGGGGGAACUC
1012950.0004miR395
zma-miR395c-3p
GUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
mtr-miR395j
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sbi-miR395c
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395n
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395m
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
rco-miR395e
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395m
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
stu-miR395h
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bra-miR395d-3p
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sbi-miR395e
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mdm-miR395f
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395a
GUGAAGUGCUUGGGGGAACUC
1012950.0004miR395
cca-miR395b
CUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
stu-miR395e
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ptc-miR395k
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sbi-miR395g
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bna-miR395e
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
stu-miR395g
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395i
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
rco-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sly-miR395b
CUGAAGUGUUUGGGGGAACUCC
00221008e-06miR395
stu-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cme-miR395c
UUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mes-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395l
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395p-3p
UGAAGUGUUUGGAGGAACUC
1001950.0004miR395
cpa-miR395b
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
mdm-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395d
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395h
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cme-miR395f
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ata-miR395e-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
mtr-miR395l
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395o
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395l-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
osa-miR395j
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
aly-miR395g-3p
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395g
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
aly-miR395e-3p
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395k
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sbi-miR395h
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395g
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mdm-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395p-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
stu-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395g-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395n
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395h
AUGAAGUGUUUGGGAGAACUC
1012950.0004miR395
cme-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ata-miR395b-3p
AAGUGUUUGGGGGAACUC
00221000.0001miR395
stu-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ata-miR395f-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
bdi-miR395j-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
gma-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ptc-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
lus-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395j-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395i
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
nta-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395h
AUGAAGUGUUUGGGGGAACUU
01121003e-05miR395
osa-miR395o
AUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
aly-miR395h-3p
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
vvi-miR395l
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
stu-miR395j
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
lus-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395o-3p
GUGAAGUGUUUGGGUGAACUC
1012950.0004miR395
sbi-miR395j
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395c-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
gma-miR395f
UGAAGUGUUUGGGGGAACUUU
01121003e-05miR395
ath-miR395b
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
ptc-miR395h
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395f-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
bdi-miR395n-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
atr-miR395
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ptc-miR395i
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cpa-miR395c
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
osa-miR395g
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395q
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
rco-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
aly-miR395i
CUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
zma-miR395b-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bna-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395h-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
aly-miR395d-3p
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395e
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395l
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395f
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bna-miR395f
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
mdm-miR395g
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vun-miR395
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395j
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395c
GUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
aly-miR395f-3p
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
sbi-miR395d
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ata-miR395a-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
cca-miR395c
CUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
ath-miR395e
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395l-3p
GUGAAGUGUUUGGAGGAACUC
1012950.0004miR395
osa-miR395r
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395d-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cpa-miR395a
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
vvi-miR395i
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395e
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395h-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sbi-miR395l
GUGAAGUGCUUGGGGGAACUC
1012950.0004miR395
rco-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395i-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395m
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
tae-miR395a
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395s
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395n
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
stu-miR395f
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cca-miR395a
UUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
zma-miR395n-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395m
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395a
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
ata-miR395d-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
bdi-miR395e-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
mes-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395f
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395k
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395d
UGAAGUGUUUGGGGGAACUUU
01121003e-05miR395
mtr-miR395g
UUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
rco-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
cme-miR395b
UUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
osa-miR395b
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
tcc-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ptc-miR395f
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bra-miR395c-3p
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
zma-miR395f-3p
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
gma-miR395j
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
aly-miR395b-3p
CUGAAGUGUUUGGGGGGACUC
1012950.0004miR395
bdi-miR395k-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
mdm-miR395h
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sbi-miR395f
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395a
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ptc-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395b
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395o-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
sbi-miR395b
GUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
bdi-miR395g-3p
UGAAGUGUUUGGGGGAACUC
00001008e-06miR395
bna-miR395c
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
csi-miR395
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mdm-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
vvi-miR395d
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
sly-miR395a
CUGAAGUGUUUGGGGGAACUCC
00221008e-06miR395
mes-miR395a
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
ppe-miR395h
CUGAAGUGUUUGGGGGAACUC
00111008e-06miR395
mtr-miR395c
AUGAAGUGUUUGGGGGAACUC
00111008e-06miR395

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot