Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_332

UGCAUUUGCACCUGCACCUGC 21nt
Associated miRBase1 families
miR530 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
cme-miR530a
UGCAUUUGCACCUGCACCUU
01121002e-05miR530
tcc-miR530b
UGCAUUUGCACCUGCACCUU
01121002e-05miR530
lus-miR530a
UGCAUUUGCACCUGCACCUU
01121002e-05miR530
lus-miR530b
UGCAUUUGCACCUGCACCUU
01121002e-05miR530
bdi-miR530b
UGCAUUUGCACCUGCACCUAC
02021002e-05miR530
mes-miR530a
UGCAUUUGCACCUGCACCUU
01121002e-05miR530
mes-miR530b
UGCAUUUGCACCUGCACCUU
01121002e-05miR530
csi-miR530a
UGCAUUUGCACCUGCACCUUG
02021002e-05miR530
bdi-miR530a
UGCAUUUGCACCUGCACCUAC
02021002e-05miR530
osa-miR530-5p
UGCAUUUGCACCUGCACCUA
01121002e-05miR530
ptc-miR530a
UGCAUUUGCACCUGCACCUU
01121002e-05miR530
tcc-miR530a
UGCAUUUGCACCUGCACCUC
01121002e-05miR530
htu-miR530
UGCAUUUGCACCUGCACCUU
01121002e-05miR530

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot