Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3695

AGAAUCCUGAUGAUGCUGCAG 21nt
Associated miRBase1 families
miR172 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
ptc-miR172g-3p
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
egu-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
nta-miR172b
AGAAUCAUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172a
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
lus-miR172h
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mtr-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
lus-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
lus-miR172d
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
sbi-miR172a
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
stu-miR172d-3p
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
ppe-miR172a-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mes-miR172d
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
lja-miR172a
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
ptc-miR172i
AGAAUCCUGAUGAUGCUGCAA
01011007e-06miR172
cme-miR172e
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
sbi-miR172f
AGAAUCCUGAUGAUGCUGCAC
01011007e-06miR172
nta-miR172g
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ptc-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
aly-miR172a-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
bna-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
cme-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ssl-miR172
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
nta-miR172e
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
nta-miR172i
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mes-miR172e
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
ata-miR172b-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
bra-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
bra-miR172c-3p
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
osa-miR172d-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ppe-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
cme-miR172a
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
aly-miR172b-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ghr-miR172
AGAAUCCUGAUGAUGCUGCAG
00001002e-06miR172
bol-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
dpr-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mtr-miR172a
AGAAUCCUGAUGAUGCUGCAG
00001002e-06miR172
lus-miR172i
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
mdm-miR172m
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
lus-miR172f
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
osa-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
sbi-miR172c
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
lus-miR172c
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
tcc-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ptc-miR172h-3p
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
ath-miR172c
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
mdm-miR172o
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
lja-miR172b
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
aly-miR172f-3p
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
cca-miR172
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
zma-miR172c-3p
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
dpr-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
gma-miR172c
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
nta-miR172f
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mtr-miR172d-3p
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
aly-miR172d-3p
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
gma-miR172h-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mes-miR172f
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
gma-miR172f
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
stu-miR172e-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
nta-miR172c
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mes-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172n
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
vun-miR172
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172h
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ath-miR172b-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
gma-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
zma-miR172d-3p
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
egu-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172g
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
egu-miR172c
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
nta-miR172d
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172f
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
bra-miR172b-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mtr-miR172c-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ptc-miR172f
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172b
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
aly-miR172c-3p
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
rco-miR172
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
sbi-miR172d
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
lja-miR172c
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
ptc-miR172c
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
sly-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
cme-miR172c
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
sly-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
stu-miR172a-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ptc-miR172b-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172l
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
vvi-miR172c
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
zma-miR172a
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
lus-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172c
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
ath-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
nta-miR172h
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
aqc-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
csi-miR172a-3p
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
mdm-miR172d
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
mdm-miR172e
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
zma-miR172b-3p
AGAAUCUUGAUGAUGCUGCA
1012950.0003miR172
mes-miR172b
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
tcc-miR172d
AGAAUCCUGAUGAUGCUGCAU
01011007e-06miR172
bdi-miR172a-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
tcc-miR172e
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
ath-miR172d-3p
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
bna-miR172d
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
ppe-miR172d
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
bdi-miR172d
AGAAUCCUGAUGAUGCUGCAG
00001002e-06miR172
lus-miR172e
GGAAUCUUGAUGAUGCUGCAG
1102950.0003miR172
nta-miR172a
AGAAUCUUGAUGAUGCUGCAG
100195.249e-05miR172
gma-miR172b-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
bol-miR172a
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172
stu-miR172b-3p
AGAAUCUUGAUGAUGCUGCAU
1102950.0003miR172

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot