Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3724

UGACAGAAGAGAGAGAGCACG 21nt
Associated miRBase1 families
miR156 miR157 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
mdm-miR156e
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ptc-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ghr-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
gma-miR156v
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
csi-miR156
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
han-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aly-miR156e-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bra-miR156a-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
gma-miR156q
UGACAGAAGAGAGUGAGCACU
1102950.0003miR156
mes-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156m
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
rco-miR156d
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
gma-miR156x
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mtr-miR156d-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
nta-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ata-miR156d-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bna-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aly-miR156h-5p
UGACAGAAGAAAGAGAGCAC
1012950.0003miR156
har-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
hci-miR156b
UGACAGAAGAGAGGGAGCAC
1012950.0003miR156
mdm-miR156g
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
atr-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ppe-miR156e
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bra-miR156b-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ppe-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
far-miR156b
UUGACAGAAGAGAGAGAGCAC
00221007e-06miR156
ptc-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aly-miR156a-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bdi-miR156h-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ata-miR156e-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
vvi-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156i
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
dpr-miR156a
UGACAGAAGAGAGGGAGCAC
1012950.0003miR156
ahy-miR156c
UUGACAGAAGAGAGAGAGCAC
00221007e-06miR156
ssp-miR156
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
ata-miR156c-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
cme-miR156g
UGACAGAAGAGAGGGAGCAC
1012950.0003miR156
lus-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
sbi-miR156i
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
dpr-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aly-miR156c-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
nta-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
sbi-miR156g
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
zma-miR156l-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
tcc-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
cme-miR156f
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
gma-miR156b
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
mtr-miR156c-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
cpa-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
hvu-miR156b
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
cpa-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
vvi-miR156a
UGACAGAAGAGAGGGAGCAC
1012950.0003miR156
atr-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mes-miR156f
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aqc-miR156b
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
mdm-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bra-miR156c-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ath-miR156i
UGACAGAAGAGAGAGAGCAG
01121002e-05miR156
zma-miR156j-5p
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
tcc-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156h
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bdi-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156l
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ppt-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
nta-miR156e
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
nta-miR156h
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
rco-miR156e
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
hvu-miR156a
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
mdm-miR156u
UUGACAGAAGAGAGAGAGCAC
00221007e-06miR156
aly-miR157d-5p
UGACAGAAGAUAGAGAGCAC
1012950.0003miR157
mes-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
osa-miR156k
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
bdi-miR156b-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ssl-miR156
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
nta-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156y
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
bra-miR156e-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
lus-miR156g
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aly-miR156b-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ppt-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aly-miR156f-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ppe-miR156a
UGACAGAAGAAAGAGAGCAC
1012950.0003miR156
far-miR156a
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
rco-miR156a
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
gma-miR156h
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
stu-miR156k-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
stu-miR156g-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ptc-miR156k
UGACAGAAGAGAGGGAGCAC
1012950.0003miR156
rco-miR156c
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
stu-miR156i-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156v
UUGACAGAAGAGAGAGAGCAC
00221007e-06miR156
nta-miR156g
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
gma-miR156u
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
han-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ptc-miR156e
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
lus-miR156d
UGACAGAAGAAAGAGAGCAC
1012950.0003miR156
ata-miR156b-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
cme-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bdi-miR156f-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
gma-miR156w
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
stu-miR156h-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mtr-miR156i-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
htu-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ptc-miR156f
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ppe-miR156f
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
bdi-miR156a
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
cme-miR156i
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bdi-miR156g-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
vvi-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bdi-miR156i-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mes-miR156e
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
stu-miR156j-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
hpa-miR156a
UGACAGAAGAGAGAGAGCAC
00111007e-06miR156
mdm-miR156w
UUGACAGAAGAGAGAGAGCAC
00221007e-06miR156
bna-miR156e
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bra-miR156f-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ptc-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
cca-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
gma-miR156y
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mtr-miR156a
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
sly-miR156d-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
vun-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mes-miR156k
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
ghr-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
tcc-miR156g
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mtr-miR156b-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156n
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156z
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
ppe-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bra-miR156d-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aly-miR156d-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
nta-miR156j
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
cpa-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ata-miR156a-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ctr-miR156
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
sbi-miR156f
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
aqc-miR156a
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
stu-miR156e
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
vvi-miR156h
UGACAGAAGAGAGAGAGCAU
01121002e-05miR156
ahy-miR156a
UGACAGAAGAGAGAGAGCAC
00111007e-06miR156
ath-miR156j
UGACAGAAGAGAGAGAGCAC
00111007e-06miR156
cme-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bra-miR156g-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156t
UUGACAGAAGAGAGAGAGCAC
00221007e-06miR156
rco-miR156b
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
tae-miR156
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
mes-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
sbi-miR156h
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
gma-miR156s
UGACAGAAGAGAGUGAGCACU
1102950.0003miR156
bdi-miR156j
UGACAGAAGAGAGAGAGCAC
00111007e-06miR156
mdm-miR156aa
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
bna-miR156a
UGACAGAAGAGAGUGAGCACA
1102950.0003miR156
ghr-miR156a
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
gma-miR156f
UUGACAGAAGAGAGAGAGCACA
01121007e-06miR156
tcc-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
cme-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
cpa-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156o
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
cme-miR156h
UGACAGAAGAGAGGGAGCAC
1012950.0003miR156
mes-miR156g
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156f
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156x
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
mdm-miR156j
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mdm-miR156k
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
mes-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
tcc-miR156a
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
vvi-miR156d
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
sbi-miR156d
UGACAGAAGAGAGAGAGCACA
01011007e-06miR156
nta-miR156i
UGACAGAAGAUAGAGAGCAC
1012950.0003miR156
ppt-miR156b
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bdi-miR156d-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
ppe-miR156b
UGACAGAAGAAAGAGAGCAC
1012950.0003miR156
bdi-miR156e-5p
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
bna-miR156f
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156
nta-miR156c
UGACAGAAGAGAGUGAGCAC
1012950.0003miR156

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot