Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3736

UUGACAGAAGAGAGGGAGCAU 21nt
Associated miRBase1 families
miR156 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
hci-miR156b
UGACAGAAGAGAGGGAGCAC
01121002e-05miR156
far-miR156b
UUGACAGAAGAGAGAGAGCAC
1102950.0003miR156
ahy-miR156c
UUGACAGAAGAGAGAGAGCAC
1102950.0003miR156
dpr-miR156a
UGACAGAAGAGAGGGAGCAC
01121002e-05miR156
cme-miR156g
UGACAGAAGAGAGGGAGCAC
01121002e-05miR156
gma-miR156o
UUGACAGAAGAGAGUGAGCAC
1102950.0003miR156
gma-miR156t
UUGACAGAAGAAAGGGAGCAC
1102950.0003miR156
vvi-miR156a
UGACAGAAGAGAGGGAGCAC
01121002e-05miR156
mdm-miR156u
UUGACAGAAGAGAGAGAGCAC
1102950.0003miR156
har-miR156c
UGACAGAAGAGAGGGAGCA
00221002e-05miR156
ptc-miR156k
UGACAGAAGAGAGGGAGCAC
01121002e-05miR156
mdm-miR156v
UUGACAGAAGAGAGAGAGCAC
1102950.0003miR156
mdm-miR156w
UUGACAGAAGAGAGAGAGCAC
1102950.0003miR156
gma-miR156k
UUGACAGAAGAGAGUGAGCAC
1102950.0003miR156
gma-miR156n
UUGACAGAAGAGAGUGAGCAC
1102950.0003miR156
vvi-miR156h
UGACAGAAGAGAGAGAGCAU
1012950.0003miR156
gma-miR156p
UUGACAGAAGAAAGGGAGCAC
1102950.0003miR156
mdm-miR156t
UUGACAGAAGAGAGAGAGCAC
1102950.0003miR156
cme-miR156h
UGACAGAAGAGAGGGAGCAC
01121002e-05miR156
smo-miR156d
UUGACAGAAGACAGGGAGCAC
1102950.0003miR156

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot