Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3755

UUUGGAUUGAAGGGAGCUCUG 21nt
Associated miRBase1 families
miR159 
Predicted by our predictors: apMir_20860

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
nta-miR159
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
bdi-miR159a-3p
CUUGGAUUGAAGGGAGCUCU
01121002e-05miR159
mes-miR159b
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
ssp-miR159a
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
zma-miR159g-3p
UUUGGAGUGAAGGGAGUUCUG
200290.480.004miR159
sbi-miR159a
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
zma-miR159k-3p
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
aly-miR159b-3p
UUUGGAUUGAAGGGAGCUCUU
01011007e-06miR159
pvu-miR159a.1
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
vvi-miR159c
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
bna-miR159
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
lus-miR159c
UUUGGAUUGAAGGGAGCUCUU
01011007e-06miR159
sof-miR159d
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
zma-miR159a-3p
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
zma-miR159i-3p
UUUGGAGUGAAGGGAGCUCUG
100195.249e-05miR159
far-miR159
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
ath-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
mes-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
hvu-miR159b
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
aly-miR159c-3p
UUUGGAUUGAAGGGAGCUCCU
02021002e-05miR159
osa-miR159a.1
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
tae-miR159a
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
bdi-miR159b-3p.1
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
zma-miR159f-3p
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
sof-miR159b
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
mtr-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
rco-miR159
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
htu-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
cme-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
zma-miR159b-3p
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
ath-miR159b-3p
UUUGGAUUGAAGGGAGCUCUU
01011007e-06miR159
mes-miR159d
AUUGGAGUGAAGGGAGCUCUG
1102950.0003miR159
ppe-miR159
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
ptc-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
atr-miR159
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
bra-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
csi-miR159
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
mes-miR159c
AUUGGAGUGAAGGGAGCUCUG
1102950.0003miR159
gma-miR159e-3p
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
hbr-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
lus-miR159b
UUUGGAUUGAAGGGAGCUCUC
01011007e-06miR159
osa-miR159b
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
pde-miR159
UUUGGUUUGAAGGGAGCUCUA
1102950.0003miR159
ahy-miR159
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
sof-miR159e
UUUGGAUUGAAAGGAGCUCUU
1102950.0003miR159
cpa-miR159a
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
osa-miR159f
CUUGGAUUGAAGGGAGCUCUA
02021002e-05miR159
hvu-miR159a
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
sly-miR159
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
sof-miR159a
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
zma-miR159h-3p
UUUGGAGUGAAGGGAGCUCUG
100195.249e-05miR159
bdi-miR159c
UUUGGUUUGAAGGGGGCUCUG
200290.480.004miR159
tae-miR159b
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
ptc-miR159b
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
gma-miR159a-3p
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
aqc-miR159
UUUGGACUGAAGGGAGCUCUA
1102950.0003miR159
aly-miR159a-3p
UUUGGAUUGAAGGGAGCUCUA
01011007e-06miR159
zma-miR159j-3p
UUUGGAUUGAAGGGAGCUCUG
00001002e-06miR159
ath-miR159c
UUUGGAUUGAAGGGAGCUCCU
02021002e-05miR159

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Amine M. Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot