Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3769

UGUGUUCUCAGGUCGCCCCCG 21nt
Associated miRBase1 families
miR398 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
mdm-miR398c
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
tae-miR398
UGUGUUCUCAGGUCGCCCCCG
00001002e-06miR398
gma-miR398d
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
mtr-miR398c
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
ppe-miR398a-3p
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
ptc-miR398c-3p
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
osa-miR398b
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
vvi-miR398b
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
sbi-miR398
UGUGUUCUCAGGUCGCCCCCG
00001002e-06miR398
ptc-miR398b
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
rco-miR398b
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
cca-miR398
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
lus-miR398a
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
gma-miR398c
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
nta-miR398
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
ata-miR398f-3p
UGUGUUCUCAGGUCGCCCCCG
00001002e-06miR398
zma-miR398b-3p
UGUGUUCUCAGGUCGCCCCCG
00001002e-06miR398
aqc-miR398b
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
zma-miR398a-3p
UGUGUUCUCAGGUCGCCCCCG
00001002e-06miR398
vvi-miR398c
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
ata-miR398g-3p
UGUGUUCUCAGGUCGCCCCCG
00001002e-06miR398
tcc-miR398a
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
bdi-miR398a
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
mdm-miR398b
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
mtr-miR398b
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398
cme-miR398a
UGUGUUCUCAGGUCGCCCCUG
02021002e-05miR398

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot