Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3806

UGAUUGAGCCGUGCCAAUAUC 21nt
Associated miRBase1 families
miR171 miR170 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
ptc-miR171k
GGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
zma-miR171j-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
lus-miR171e
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ptc-miR171g-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
hvu-miR171-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ppe-miR171g
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mes-miR171i
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
bdi-miR171a
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
pde-miR171
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
bra-miR171e
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
htu-miR171b
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ppe-miR171c
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
aqc-miR171d
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
bdi-miR171d-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
lja-miR171b
UGAUUGAGCCGCGUCAAUAUC
200290.480.004miR171
gma-miR171f
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mtr-miR171d
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
tcc-miR171g
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
aqc-miR171b
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ath-miR170-3p
UGAUUGAGCCGUGUCAAUAUC
100195.249e-05miR170
osa-miR171c-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
gma-miR171u
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
tcc-miR171b
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
lus-miR171g
UGAUUGAGCCGCGUCAAUAUC
200290.480.004miR171
tcc-miR171d
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cpa-miR171c
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cpa-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
aly-miR170-3p
UGAUUGAGCCGUGUCAAUAUC
100195.249e-05miR170
stu-miR171a-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mes-miR171f
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
bna-miR171f
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
rco-miR171f
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cpa-miR171d
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
lus-miR171a
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
gma-miR171j-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ptc-miR171i
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cca-miR171
UGAUUGAGCCGCACCAAUAUC
200290.480.004miR171
osa-miR171a
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
rco-miR171c
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cme-miR171h
UGAUUGAGCCGCGUCAAUAUC
200290.480.004miR171
zma-miR171i-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
tcc-miR171c
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
htu-miR171c
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
vvi-miR171j
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
rco-miR171g
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
zma-miR171n-3p
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
vvi-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ptc-miR171d
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
vvi-miR171c
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
bdi-miR171e
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cme-miR171c
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
far-miR171
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mtr-miR171b
UGAUUGAGCCGCGUCAAUAUC
200290.480.004miR171
lus-miR171f
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
osa-miR171b
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ptc-miR171h-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
osa-miR171f-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mtr-miR171e-3p
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
rco-miR171e
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
lus-miR171c
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
vvi-miR171d
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
zma-miR171a-3p
UGAUUGAGCCGCGCCAAUAU
1012950.0003miR171
zma-miR171c-3p
UGACUGAGCCGUGCCAAUAUC
100195.249e-05miR171
mdm-miR171c
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
mdm-miR171e
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
sbi-miR171k
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
tcc-miR171e
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ata-miR171d-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mes-miR171e
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
ath-miR171a-3p
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
bdi-miR171b
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
sbi-miR171g
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
lus-miR171b
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
gma-miR171e
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ppe-miR171f
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
vvi-miR171b
UGAUUGAGCCGCGUCAAUAUC
200290.480.004miR171
tae-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
osa-miR171e-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
zma-miR171e-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ata-miR171b-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
crt-miR171
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
bna-miR171g
UGAUUGAGCCGCGCCAAUAUCU
101295.249e-05miR171
mdm-miR171g
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
sbi-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mes-miR171g
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
stu-miR171c-3p
UGAUUGAGCCGUGUCAAUAUC
100195.249e-05miR171
gma-miR171g
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
lus-miR171j
UGAUUGAGCCGCGUCAAUAUC
200290.480.004miR171
stu-miR171e
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
zma-miR171d-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
tcc-miR171f
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mtr-miR171a
UGAUUGAGUCGUGCCAAUAUC
100195.249e-05miR171
mes-miR171h
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mes-miR171k
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
sbi-miR171i
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
sly-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ppe-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cme-miR171a
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
atr-miR171c
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
bdi-miR171c-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cme-miR171e
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
hpa-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
lja-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
gma-miR171d
UGAUUGAGUCGUGUCAAUAUC
200290.480.004miR171
cme-miR171f
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
sbi-miR171j
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
aly-miR171a-3p
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
cme-miR171g
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
osa-miR171d-3p
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
cpa-miR171b
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ptc-miR171e
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
tcc-miR171h
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
atr-miR171a
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
ptc-miR171f
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
aqc-miR171f
UAAUUGAGCCGUGCCAAUAUC
02021002e-05miR171
vvi-miR171e
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
mdm-miR171d
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
tcc-miR171a
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
htu-miR171a
UGAUUGAGCCGUGCCAAUAU
00111007e-06miR171
rco-miR171d
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mdm-miR171h
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ptc-miR171c
AGAUUGAGCCGCGCCAAUAUC
1102950.0003miR171
aqc-miR171a
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
nta-miR171c
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
sbi-miR171b
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mes-miR171j
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
ccl-miR171
UGAUUGAGCCGCGCCAAUAUC
100195.249e-05miR171
vvi-miR171i
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171
mtr-miR171c
UGAUUGAGCCGUGCCAAUAUU
01011007e-06miR171
sbi-miR171d
UGAUUGAGCCGUGCCAAUAUC
00001002e-06miR171

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot