Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3991

AGAAUCCUGAUGAUGCUGCAGC 22nt
Associated miRBase1 families
miR172 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
lja-miR172a
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
ptc-miR172i
AGAAUCCUGAUGAUGCUGCAA
01121008e-06miR172
cme-miR172e
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
sbi-miR172f
AGAAUCCUGAUGAUGCUGCAC
01121008e-06miR172
bra-miR172c-3p
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
ghr-miR172
AGAAUCCUGAUGAUGCUGCAG
00111002e-06miR172
mtr-miR172a
AGAAUCCUGAUGAUGCUGCAG
00111002e-06miR172
mdm-miR172m
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
ath-miR172c
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
mdm-miR172o
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
aly-miR172f-3p
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
aly-miR172d-3p
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
mdm-miR172n
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
aly-miR172c-3p
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
tcc-miR172d
AGAAUCCUGAUGAUGCUGCAU
01121008e-06miR172
ath-miR172d-3p
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
bna-miR172d
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172
bdi-miR172d
AGAAUCCUGAUGAUGCUGCAG
00111002e-06miR172
nta-miR172a
AGAAUCUUGAUGAUGCUGCAG
101295.240.0001miR172

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot