Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_3992

UAGCCAAGGAUGAUUUGCCUGU 22nt
Associated miRBase1 families
miR169 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
ppe-miR169f
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
ata-miR169b-5p
UAGCCAAGGAUGAUUUGCCUGUG
00111006e-07miR169
bna-miR169l
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
sly-miR169b
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
zma-miR169k-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ppe-miR169i
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
osa-miR169i-5p.1
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ptc-miR169j
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
aly-miR169m-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
bna-miR169k
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
aly-miR169j-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
bdi-miR169k-5p
UAGCCAAGGAUGAUUUGCCUGU
00001006e-07miR169
mes-miR169p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
aly-miR169k-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
lus-miR169c
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
tcc-miR169i
UAGCCAAGGAUGAGUUGCCUG
101295.240.0001miR169
zma-miR169l-5p
UAGCCAGGGAUGAUUUGCCUG
101295.240.0001miR169
bna-miR169h
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
ata-miR169i-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
mes-miR169q
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
osa-miR169r-5p
UAGCCAAGGAUGAUUUGCCUG
00111002e-06miR169
ath-miR169m
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ptc-miR169l
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ptc-miR169m
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
zma-miR169i-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
sbi-miR169g
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
bna-miR169i
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
vvi-miR169e
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
osa-miR169k
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
tcc-miR169h
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
osa-miR169m
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
cme-miR169n
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
sbi-miR169l
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
mes-miR169o
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ppe-miR169h
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
cme-miR169e
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ath-miR169h
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ptc-miR169k
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
aly-miR169i-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
aqc-miR169b
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ppe-miR169g
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
ath-miR169n
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
bdi-miR169e-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
mdm-miR169b
UAGCCAAGGAUGAUUUGCCUGC
01011002e-06miR169
lus-miR169k
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ath-miR169i
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
osa-miR169l
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
zma-miR169j-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
bna-miR169g
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
ppe-miR169j
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
ath-miR169k
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
sbi-miR169o
UAGCCAAGGAUGAUUUGCCUG
00111002e-06miR169
ghr-miR169a
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ghb-miR169a
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
aly-miR169h-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
mes-miR169u
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
mes-miR169w
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
tcc-miR169j
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
bdi-miR169g
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
mes-miR169s
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ata-miR169a-5p
UAGCCAAGGAUGAUUUGCCUGUG
00111006e-07miR169
ata-miR169j-5p
UAGCCAAGGAUGAUUUGCCUGUG
00111006e-07miR169
ath-miR169l
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
lus-miR169b
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ath-miR169j
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
bna-miR169j
UAGCCAAGGAUGACUUGCCUGC
110295.240.0001miR169
osa-miR169j
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
sbi-miR169f
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
mes-miR169y
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
mes-miR169aa
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
ptc-miR169i
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
aly-miR169l-5p
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169
osa-miR169h
UAGCCAAGGAUGACUUGCCUG
101295.240.0001miR169

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot