Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_4040

CUUGGACUGAAGGGUGCUCCCG 22nt
Associated miRBase1 families
miR319 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
sbi-miR319b
UUGGACUGAAGGGUGCUCCC
00221008e-06miR319
sbi-miR319a
UUGGACUGAAGGGUGCUCCC
00221008e-06miR319
zma-miR319a-3p
UUGGACUGAAGGGUGCUCCC
00221008e-06miR319
zma-miR319d-3p
UUGGACUGAAGGGUGCUCCC
00221008e-06miR319
ppt-miR319c
CUUGGACUGAAGGGAGCUCCC
101295.240.0001miR319
zma-miR319c-3p
UUGGACUGAAGGGUGCUCCC
00221008e-06miR319
ppt-miR319d-3p
CUUGGACUGAAGGGAGCUCCC
101295.240.0001miR319
bdi-miR319b-3p
UUGGACUGAAGGGUGCUCCCU
01121008e-06miR319
ppt-miR319e
CUUGGACUGAAGGGAGCUCCC
101295.240.0001miR319
zma-miR319b-3p
UUGGACUGAAGGGUGCUCCC
00221008e-06miR319
osa-miR319b
UUGGACUGAAGGGUGCUCCC
00221008e-06miR319
osa-miR319a-3p.2-3p
UUGGACUGAAGGGUGCUCCC
00221008e-06miR319

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot