Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_406

UGCCAAAGGAGAAUUGCCCUG 21nt
Associated miRBase1 families
miR399 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
tcc-miR399a
CGCCAAAGGAGAGUUGCCCUG
1102950.0003miR399
csi-miR399c
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
ssl-miR399
UGCCAAAGGAGAAUUGCCCGG
02021002e-05miR399
cme-miR399d
UGCCAAAGGAGAGUUGCCCUU
1102950.0003miR399
sbi-miR399i
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
sbi-miR399a
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
gma-miR399i
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
mtr-miR399l
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
tcc-miR399e
CGCCAAAGGAGAAUUGCCCUG
01011007e-06miR399
mdm-miR399i
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
zma-miR399c-3p
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
mdm-miR399c
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
osa-miR399j
UGCCAAAGGAGAGUUGCCCUA
1102950.0003miR399
bdi-miR399a
UGCCAAAGGAGAAUUACCCUG
100195.249e-05miR399
cme-miR399b
UGCCAAAGGAGAGUUGCCCUA
1102950.0003miR399
cca-miR399
UGCCAAAGGAGAUUUGCCCUG
100195.249e-05miR399
csi-miR399e
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
zma-miR399d-3p
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
gma-miR399b
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
zma-miR399a-3p
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
rco-miR399a
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
mdm-miR399d
UGCCAAAGGAGAGUUGCCCUA
1102950.0003miR399
zma-miR399i-3p
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
ath-miR399c-3p
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
osa-miR399d
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
vvi-miR399b
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
osa-miR399b
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
tcc-miR399i
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
osa-miR399i
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
zma-miR399e-3p
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
ath-miR399a
UGCCAAAGGAGAUUUGCCCUG
100195.249e-05miR399
aly-miR399b-3p
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
ptc-miR399i
UGCCAAAGGAGAGUUGCCCUA
1102950.0003miR399
aly-miR399f-3p
UGCCAAAGGAGAUUUGCCCUG
100195.249e-05miR399
pvu-miR399a
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
tcc-miR399g
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
stu-miR399d-3p
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
mtr-miR399o
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
sbi-miR399c
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
mtr-miR399k
UGCCAAAGAAGAUUUGCCCUG
200290.480.004miR399
stu-miR399f-3p
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
lus-miR399b
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
aly-miR399c-3p
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
bdi-miR399c
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
ath-miR399b
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
ptc-miR399g
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
mtr-miR399b
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
csi-miR399d
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
stu-miR399c-3p
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
ata-miR399a-3p
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
mdm-miR399b
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
vun-miR399a
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
ghr-miR399d
UGCCAAAGGAGAUUUGCCCUG
100195.249e-05miR399
gma-miR399c
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
vvi-miR399a
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
stu-miR399e-3p
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
csi-miR399b
UGCCAAAGGAGAGUUGCCCUA
1102950.0003miR399
sbi-miR399b
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
lus-miR399d
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
sly-miR399
UGCCAAAGGAGAGUUGCCCUA
1102950.0003miR399
cme-miR399e
UGCCAAAGGAGAGUUGCCCUU
1102950.0003miR399
zma-miR399h-3p
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
tcc-miR399f
UGCCAGAGGAGAUUUGCCCUG
200290.480.004miR399
stu-miR399b-3p
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
mes-miR399a
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
aqc-miR399
UGCCAAAGGAGAGUUGCCCUA
1102950.0003miR399
rco-miR399d
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
ptc-miR399f
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
osa-miR399c
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
bdi-miR399b
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
vvi-miR399i
CGCCAAAGGAGAGUUGCCCUG
1102950.0003miR399
osa-miR399a
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
stu-miR399a-3p
UGCCAAAGGAGAGCUGCCCUG
200290.480.004miR399
mtr-miR399h
UGCCAAAGGAGAUUUGCCCUG
100195.249e-05miR399
mtr-miR399p
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
sbi-miR399j
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
mtr-miR399i
UGCCAAAGGAGAUUUGCCCUG
100195.249e-05miR399
sbi-miR399d
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
ata-miR399b-3p
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
ptc-miR399h
UGCCAAAGGAGAGUUUCCCUG
200290.480.004miR399
stu-miR399i-3p
UGCCAAAGGAGAGUUGCCCUA
1102950.0003miR399
vvi-miR399h
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
sbi-miR399h
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
mtr-miR399c
UGCCAAAGGAGAUUUGCCCUG
100195.249e-05miR399
mes-miR399f
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
tae-miR399
UGCCAAAGGAGAAUUGCCC
00221002e-05miR399
vun-miR399b
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
gma-miR399a
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
mdm-miR399a
UGCCAAAGGAGAAUUGCCCUG
00001002e-06miR399
zma-miR399j-3p
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
gma-miR399h
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
mdm-miR399j
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399
vvi-miR399c
UGCCAAAGGAGAGUUGCCCUG
100195.249e-05miR399

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot