Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_4496

UGUUGGCUCGACUCACUCAGA 21nt
Associated miRBase1 families
miR171 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
osa-miR171e-5p
UGUUGGCUCGGCUCACUCAGA
100195.249e-05miR171
hvu-miR171-5p
UGUUGGCUCGACUCACUCAGA
00001002e-06miR171
ata-miR171d-5p
UGUUGGCUCGACUCACUCAGA
00001002e-06miR171
zma-miR171d-5p
UGUUGGCUCGGCUCACUCAGA
100195.249e-05miR171
bdi-miR171d-5p
UGUUGGCUCGACUCACUCAGA
00001002e-06miR171
zma-miR171e-5p
UGUUGGCUCGGCUCACUCAGA
100195.249e-05miR171
osa-miR171d-5p
UGUUGGCCCGGCUCACUCAGA
200290.480.004miR171

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot