Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_4526

GCUCACCCUCUCUCUGUCAGCU 22nt
Associated miRBase1 families
miR156 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
bdi-miR156i-3p
GCUCACCCUCUCUCUGUCAGC
00111002e-06miR156
ata-miR156a-3p
GCUCACCCUCUCUCUGUCAGC
00111002e-06miR156
bdi-miR156g-3p
GCUCACCCUCUCUCUGUCAGC
00111002e-06miR156
ata-miR156e-3p
GCUCACCCUCUCUCUGUCAGC
00111002e-06miR156

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot