Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_4644

GACAGAAGAGAGAGAGCACA 20nt
Associated miRBase1 families
miR156 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
rco-miR156d
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
ssp-miR156
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
gma-miR156b
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
hvu-miR156b
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
zma-miR156j-5p
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
rco-miR156e
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
hvu-miR156a
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
osa-miR156k
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
ssl-miR156
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
far-miR156a
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
rco-miR156a
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
rco-miR156c
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
bdi-miR156a
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
hpa-miR156a
UGACAGAAGAGAGAGAGCAC
00221003e-05miR156
mtr-miR156a
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
mes-miR156k
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
ahy-miR156a
UGACAGAAGAGAGAGAGCAC
00221003e-05miR156
ath-miR156j
UGACAGAAGAGAGAGAGCAC
00221003e-05miR156
rco-miR156b
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
tae-miR156
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
bdi-miR156j
UGACAGAAGAGAGAGAGCAC
00221003e-05miR156
bna-miR156a
UGACAGAAGAGAGUGAGCACA
1012950.0004miR156
gma-miR156f
UUGACAGAAGAGAGAGAGCACA
00221008e-06miR156
tcc-miR156a
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156
sbi-miR156d
UGACAGAAGAGAGAGAGCACA
00111008e-06miR156

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot