Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_4652

UGAAGCUGCCAGCAUGAUCUAG 22nt
Associated miRBase1 families
miR167 
Predicted by our predictors: apMir_24939

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
bra-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
nta-miR167b
UGAAGCUGCCAGCAUGAUCUGG
02021008e-06miR167
bna-miR167b
UGAAGCUGCCAGCAUGAUCUAA
01011002e-06miR167
ata-miR167b-5p
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
bra-miR167d
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mes-miR167g
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
nta-miR167d
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
ctr-miR167
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
bdi-miR167g
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
ptc-miR167d
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
ppe-miR167c
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
lja-miR167
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
osa-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
aly-miR167b-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
zma-miR167b-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
ghr-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mes-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
gma-miR167e
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
gma-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mes-miR167c
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
tae-miR167b
UGAAGCUGACAGCAUGAUCUA
101295.240.0001miR167
mes-miR167f
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
zma-miR167g-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
sbi-miR167e
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
dpr-miR167c
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
zma-miR167d-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
cme-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
gma-miR167d
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
ppe-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mdm-miR167j
UGAAGCUGCCAGCAUGAUCUUA
02021008e-06miR167
vvi-miR167d
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
sof-miR167b
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
lus-miR167b
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
mdm-miR167e
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
ath-miR167d
UGAAGCUGCCAGCAUGAUCUGG
02021008e-06miR167
bdi-miR167e-5p
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
stu-miR167d-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
lus-miR167d
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
lja-miR167a
UGAAGCUGCCAGCAUGAUCU
00221008e-06miR167
ccl-miR167a
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
rco-miR167c
UGAAGCUGCCAGCAUGAUCUGG
02021008e-06miR167
zma-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
sbi-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
zma-miR167c-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
vvi-miR167a
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
ptc-miR167g-5p
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
csi-miR167b
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
ata-miR167d-5p
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
ssp-miR167b
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
bdi-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
osa-miR167h-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
cpa-miR167d
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
ath-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
osa-miR167e-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
sbi-miR167g
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
mes-miR167h
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
osa-miR167d-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
mtr-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
lus-miR167a
UGAAGCUGCCAGCAUGAUCUC
01121008e-06miR167
cme-miR167c
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
ath-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mdm-miR167g
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
cpa-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
sbi-miR167i
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
bra-miR167c
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
bdi-miR167c-5p
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
mdm-miR167i
UGAAGCUGCCAGCAUGAUCUUA
02021008e-06miR167
aly-miR167d-5p
UGAAGCUGCCAGCAUGAUCUGG
02021008e-06miR167
gso-miR167a
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
lus-miR167h
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
osa-miR167f
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
stu-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
dpr-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mdm-miR167c
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mdm-miR167d
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
sof-miR167a
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
bna-miR167d
UGAAGCUGCCAGCAUGAUCU
00221008e-06miR167
vvi-miR167e
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
atr-miR167
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
tcc-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
stu-miR167c-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
gma-miR167j
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
cme-miR167d
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
osa-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
gma-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mes-miR167d
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
stu-miR167b-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
rco-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
nta-miR167c
UGAAGCUGCCAGCAUGAUCUGG
02021008e-06miR167
sbi-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
ptc-miR167e
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
zma-miR167e-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
bra-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
dpr-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
tae-miR167c-5p
UGAAGCUGCCAGCAUGAUCUGC
02021008e-06miR167
ptc-miR167c
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
cca-miR167
UGAAGCUGCCAGCAUGAUCUGG
02021008e-06miR167
bna-miR167a
UGAAGCUGCCAGCAUGAUCUAA
01011002e-06miR167
mdm-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
tcc-miR167c
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
mes-miR167a
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
gma-miR167g
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
zma-miR167j-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
tae-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
ppe-miR167d
UGAAGCUGCCAGCAUGAUCUUA
02021008e-06miR167
ppe-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
bdi-miR167d-5p
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
ata-miR167e-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
bdi-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
lus-miR167e
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
nta-miR167a
UGAAGCUGCCAGCAUGAUCUGG
02021008e-06miR167
bdi-miR167f
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
lus-miR167f
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
ghr-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
cpa-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
sbi-miR167c
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
cme-miR167f
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
mdm-miR167f
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mdm-miR167h
UGAAGCUGCCAGCAUGAUCUUA
02021008e-06miR167
csi-miR167a
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
lus-miR167i
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
ptc-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
bna-miR167c
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
zma-miR167f-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
ahy-miR167-5p
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
ccl-miR167b
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
ata-miR167f-5p
UGAAGCUGCCAGCAUGAUCUGC
02021008e-06miR167
ptc-miR167f-5p
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
lja-miR167b
UGAAGCUGCCAGCAUGAUCU
00221008e-06miR167
ata-miR167c-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
mes-miR167e
UGAAGCUGCCAGCAUGAUCUGA
02021008e-06miR167
lja-miR167c
UGAAGCUGCCAGCAUGAUCU
00221008e-06miR167
osa-miR167c-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
zma-miR167i-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
sbi-miR167h
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
gma-miR167c
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
lus-miR167c
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
sbi-miR167d
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
csi-miR167c
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
mtr-miR167b-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
osa-miR167i-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
nta-miR167e
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
gma-miR167f
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
vvi-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
rco-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
aly-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
lus-miR167g
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
cpa-miR167c
UGAAGCUGCCAGCAUGAUCUU
01121008e-06miR167
cme-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
sly-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
osa-miR167g
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
ptc-miR167b
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
tcc-miR167a
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
zma-miR167h-5p
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
ata-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00111002e-06miR167
osa-miR167j
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167
vvi-miR167c
UGAAGCUGCCAGCAUGAUCUC
01121008e-06miR167
sbi-miR167f
UGAAGCUGCCAGCAUGAUCUG
01121008e-06miR167

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot