Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_4826

UUCCGAAAGGCUUGAAGCAAAU 22nt
Associated miRBase1 families
miR9654 
Predicted by our predictors: apMir_23912

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
tae-miR9654b-3p
UUCCGAAAGGCUUGAAGCGAAU
100195.453e-05miR9654
tae-miR9654a-3p
UUCUGAAAGGCUUGAAGCGAAU
200290.910.001miR9654

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot