Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_4837

UGGGCAAGUCACCCUGGCUACC 22nt
Associated miRBase1 families
miR169 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
ata-miR169b-3p
UGGGCAAGUCAUCCUGGCUACCC
101295.453e-05miR169
ata-miR169j-3p
UGGGCAAGUCACCCUGGCUACC
00001006e-07miR169
bdi-miR169k-3p
GGGCAAGUCAGCCUGGCUACC
101295.240.0001miR169
ata-miR169a-3p
UGGGCAAGUCACCCUGGCUACC
00001006e-07miR169

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot