Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_486

GUUCCCUGCAAGCACUUCACGA 22nt
Associated miRBase1 families
miR395 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
bdi-miR395p-5p
GUUUCCUGCAAGCACUUCACG
101295.240.0001miR395
zma-miR395o-5p
GUUCUCUUCAAGCACUUCACGA
200290.910.001miR395
bdi-miR395n-5p
GUUCCCUGCAAGCACUUCACC
01121008e-06miR395
bdi-miR395l-5p
GUUCCCUGCAAGCACUUCACG
00111002e-06miR395
bdi-miR395h-5p
GUUCCCUGCAAGCACUUCACG
00111002e-06miR395
ata-miR395b-5p
GUUCCCUGCAAACACUUCACG
101295.240.0001miR395
zma-miR395n-5p
GUUCUCUACAAGCACUUCACGA
200290.910.001miR395
zma-miR395i-5p
GUUCCCUACAAGCACUUCACGA
100195.453e-05miR395

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot