Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_53

UAGCCAAGGAUGAUUUGCC 19nt
Associated miRBase1 families
miR169 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
bdi-miR169m
UAGCCAAGGAUGACUUGCCG
101294.740.001miR169
stu-miR169e-5p
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
stu-miR169h
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
stu-miR169f-5p
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
osa-miR169r-5p
UAGCCAAGGAUGAUUUGCCUG
00221002e-05miR169
atr-miR169c
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
atr-miR169a
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
stu-miR169c-5p
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
stu-miR169g
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
stu-miR169d-5p
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
sbi-miR169o
UAGCCAAGGAUGAUUUGCCUG
00221002e-05miR169
gma-miR169v
CAGCCAAGGAUGACUUGCC
110294.440.004miR169
stu-miR169a-5p
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
sbi-miR169d-5p
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169
stu-miR169b-5p
UAGCCAAGGAUGACUUGCCU
101294.740.001miR169

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot