Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_579

UUUGGAUUGAAGGGAGCUCUGCA 23nt
Associated miRBase1 families
miR159 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
ssp-miR159a
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
sbi-miR159a
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
zma-miR159k-3p
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
sof-miR159d
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
zma-miR159a-3p
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
far-miR159
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
hvu-miR159b
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
osa-miR159a.1
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
tae-miR159a
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
bdi-miR159b-3p.1
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
zma-miR159f-3p
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
sof-miR159b
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
zma-miR159b-3p
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
osa-miR159b
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
hvu-miR159a
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
sof-miR159a
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
tae-miR159b
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159
zma-miR159j-3p
UUUGGAUUGAAGGGAGCUCUG
00221002e-06miR159

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Amine M. Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot