Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_607

UGAAGCUGCCAGCAUGAUCUAAC 23nt
Associated miRBase1 families
miR167 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
bra-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
bna-miR167b
UGAAGCUGCCAGCAUGAUCUAA
00111007e-07miR167
bra-miR167d
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
nta-miR167d
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ptc-miR167d
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
osa-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
aly-miR167b-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
zma-miR167b-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ghr-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
mes-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
gma-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
mes-miR167c
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
zma-miR167d-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
cme-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
gma-miR167d
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ppe-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
vvi-miR167d
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
mdm-miR167e
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
stu-miR167d-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
lus-miR167d
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
zma-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
sbi-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
zma-miR167c-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
bdi-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ath-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
mtr-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ath-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
mdm-miR167g
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
cpa-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
sbi-miR167i
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
bra-miR167c
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
lus-miR167h
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
stu-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
dpr-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
mdm-miR167c
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
mdm-miR167d
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
vvi-miR167e
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
tcc-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
stu-miR167c-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
osa-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
gma-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
stu-miR167b-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
rco-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
sbi-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
bra-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
dpr-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ptc-miR167c
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
bna-miR167a
UGAAGCUGCCAGCAUGAUCUAA
00111007e-07miR167
mdm-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
tae-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ppe-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ata-miR167e-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
bdi-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
lus-miR167e
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
bdi-miR167f
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ghr-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
cpa-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
mdm-miR167f
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ptc-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
bna-miR167c
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ata-miR167c-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
osa-miR167c-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
lus-miR167c
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
nta-miR167e
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
vvi-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
rco-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
aly-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
cme-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
sly-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ptc-miR167b
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
tcc-miR167a
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167
ata-miR167a-5p
UGAAGCUGCCAGCAUGAUCUA
00221002e-06miR167

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot