Laboratoire bioinformatique | UQAM
Groupe de recherche en biochimie du developpement et de l'adaptation des plantes | UQAM
Wheat MicroRNA Portal
Université du Québec à Montréal

Conserved microRNA consmRNA_662

UGCCUGGCUCCCUGUAUGCCACU 23nt
Associated miRBase1 families
miR160 
Predicted by our predictors: NO

Hit IDHit sequence
in miRBase dataset
Internal mismatchesExternal mismatchesExternal gapsTotal mismatchesPercent identity (Blast)E-value (Blast)Family
bna-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ppe-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
far-miR160
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
cpa-miR160f-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
pab-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mes-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
sbi-miR160c
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
vun-miR160
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
smo-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ppt-miR160e
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ath-miR160c-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ptc-miR160c-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
bdi-miR160b-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ppe-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mes-miR160g
UGCCUGGCUCCCUGUAUGCCAUC
02021002e-06miR160
cme-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
gma-miR160f
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ath-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mtr-miR160d
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ptc-miR160b-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mdm-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
lus-miR160e
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
lus-miR160i
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
vvi-miR160c
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
lus-miR160j
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ata-miR160c-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
rco-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
bna-miR160d
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
tae-miR160
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
nta-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
osa-miR160d-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
osa-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
gma-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mdm-miR160d
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
sbi-miR160d
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
bdi-miR160d-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
cpa-miR160e
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
lus-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
cpa-miR160c-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
zma-miR160c-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
zma-miR160d-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
tcc-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
lus-miR160f
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
osa-miR160b-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ata-miR160b-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ptc-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
vvi-miR160e
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
cpa-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
aqc-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mdm-miR160c
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ppt-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
zma-miR160g-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mes-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
stu-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
bdi-miR160c-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
pab-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mtr-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
bna-miR160c
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
cme-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
stu-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
sbi-miR160e
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
bra-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
sbi-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ata-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
sbi-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
atr-miR160
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mes-miR160d
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
bna-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
aly-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
smo-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mes-miR160h
UGCCUGGCUCCCUGUAUGCCAUU
02021002e-06miR160
lus-miR160d
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ttu-miR160
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
sly-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mtr-miR160e
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
osa-miR160c-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ppt-miR160f
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
cme-miR160c
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ath-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mtr-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
ptc-miR160d
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
nta-miR160c
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
zma-miR160e
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
nta-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mdm-miR160e
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
mdm-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
cpa-miR160a
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
zma-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
aly-miR160b-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
rco-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
vvi-miR160d
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
zma-miR160b-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
bdi-miR160a-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
cca-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
lus-miR160b
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
aly-miR160c-5p
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160
lus-miR160h
UGCCUGGCUCCCUGUAUGCCA
00221002e-06miR160

1Kozomara A, Griffiths-Jones S. (2014) miRBase: annotating high confidence microRNAs using deep sequencing data. NAR 2014 42:D68-D73 PMID: 21037258
 Mohamed Amine Remita, Etienne Lord   Made with JQuery, Angular.js, Bootstrap, D3, NVD3 and jqplot